Stem-loop sequence osa-MIR156k

Accession

MI0001090 (change log)

Description

Oryza sativa miR156k stem-loop

Gene family

MIPF0000008; MIR156

Literature search

122 open access papers mention osa-MIR156k
(656 sentences)

Stem-loop

   uu  ga ug        -   -g          --a   -     c      ga 
5'   ga  g  augacaga aga  agagagcaca   ccc ggcag agcgac  c
     ||  |  |||||||| |||  ||||||||||   ||| ||||| ||||||  g
3'   cu  c  uacugucu ucu  ucucucgugu   ggg ccguc ucgcug  g
   ac  gc gu        a   ag          gcc   a     u      gc 

Deep sequencing

378295 reads, 2.61e+05 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR156 family [1]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors.

Genome context

• Coordinates (MSU7): Chr9: 18289107-18289212 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001090

Mature sequence osa-miR156k

• Accession: MIMAT0001020
• Sequence: 11 - ugacagaagagagagagcaca - 31
• Deep sequencing: 378295 reads, 2 experiments
• Evidence: by similarity; MI0000178
• Database links:
  • RNAcentral:URS0000509E19_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).