Stem-loop sequence osa-MIR159d

Accession

MI0001095 (change log)

Description

Oryza sativa miR159d stem-loop

Gene family

MIPF0000010; MIR159

Literature search

76 open access papers mention osa-MIR159d
(330 sentences)

Stem-loop

   ugau   -  ga                    u   g       ----    ug  aug  g  g    u     g u    c    -  u  u   g 
5'     gug ag  ggagcuccuuucgauccaau cag agaggaa    gugg  gg   ca cu ccgg ucaug a accu ugca gu ca gcc g
       ||| ||  |||||||||||||||||||| ||| |||||||    ||||  ||   || || |||| ||||| | |||| |||| || || |||  
3'     cac uc  ccucgagggaaguuagguua guu ucuccuu    uacc  cc   gu ga gguc aguac u uggg acgu ca gu cgg u
   -auc   a  gg                    -   a       gugu    gu  -aa  a  g    c     g u    u    u  c  c   a 

Deep sequencing

1818 reads, 1.1e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context

• Coordinates (MSU7): Chr1: 6563756-6563944 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR159d

• osa-MIR159d: Chr1: 6563756-6563944 [-]
• osa-MIR159c: Chr1: 6556048-6556244 [-]

Database links

• miRBase Tracker:MI0001095

Mature sequence osa-miR159d

• Accession: MIMAT0001025
• Sequence: 159 - auuggauugaagggagcuccg - 179
• Deep sequencing: 1775 reads, 2 experiments
• Evidence: by similarity; MI0000189
• Database links:
  • RNAcentral:URS00003FB5A8_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).