![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR159f |
|||||
Accession | MI0001097 (change log) | ||||
Description | Oryza sativa miR159f stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
76 open access papers mention osa-MIR159f | ||||
Stem-loop |
gaagaagaagac uc g ---- a aug g g u g u c - u c 5' gagcucccuucgauccaa ca gagaggaag uggu gg ca cu ccgg ucaug a accu ugca gugca gu g |||||||||||||||||| || ||||||||| |||| || || || |||| ||||| | |||| |||| ||||| || u 3' cucgagggaaguuagguu gu uucuccuuc acca cc gu ga ggcc aguac u uggg acgu cacgu cg a cucucuccacau -c a uguu c -aa a g c g u u u u g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR159f |
|
Accession | MIMAT0001027 |
Sequence |
158 - cuuggauugaagggagcucua - 178 |
Deep sequencing | 1781 reads, 2 experiments |
Evidence | by similarity; MI0000544 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|