Stem-loop sequence osa-MIR159f

Accession

MI0001097 (change log)

Description

Oryza sativa miR159f stem-loop

Gene family

MIPF0000010; MIR159

Literature search

76 open access papers mention osa-MIR159f
(349 sentences)

Stem-loop

   gaagaagaagac                  uc  g         ----    a  aug  g  g    u     g u    c    -     u  c 
5'             gagcucccuucgauccaa  ca gagaggaag    uggu gg   ca cu ccgg ucaug a accu ugca gugca gu g
               ||||||||||||||||||  || |||||||||    |||| ||   || || |||| ||||| | |||| |||| ||||| || u
3'             cucgagggaaguuagguu  gu uucuccuuc    acca cc   gu ga ggcc aguac u uggg acgu cacgu cg a
   cucucuccacau                  -c  a         uguu    c  -aa  a  g    c     g u    u    u     u  g 

Deep sequencing

1807 reads, 1.1e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context

• Coordinates (MSU7): Chr1: 6693112-6693299 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001097

Mature sequence osa-miR159f

• Accession: MIMAT0001027
• Sequence: 158 - cuuggauugaagggagcucua - 178
• Deep sequencing: 1781 reads, 2 experiments
• Evidence: by similarity; MI0000544
• Database links:
  • RNAcentral:URS0000254B5D_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).