|
miRBase |
|
Stem-loop sequence osa-MIR164e |
|||||
| Accession | MI0001105 | ||||
| Description | Oryza sativa miR164e stem-loop | ||||
| Gene family | MIPF0000045; MIR164 | ||||
| Stem-loop |
uu ag ca guguagcuucgcugcgcguccaug gugc gguggagaag gggcacgugagcggccaucca g |||| |||||||||| ||||||||||||||||||||| cacg ccaccucuuc ccuguguacuugcugguaggu c gu ag ug uugaggucuagugcgcgcaagcgg |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence is a predicted paralogue of the previously identified miR164 family [1]. It is predicted to target mRNAs coding for NAC domain transcription factors. |
||||
| Genome context |
|
||||
Mature sequence osa-miR164e |
|
| Accession | MIMAT0001035 |
| Sequence |
11 - uggagaagcagggcacgugag - 31 |
| Deep sequencing | 2739 reads, 4 experiments |
| Evidence | by similarity; MI0000197 |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|