Stem-loop sequence osa-MIR167d

Accession

MI0001109 (change log)

Description

Oryza sativa miR167d stem-loop

Gene family

MIPF0000023; MIR167_1

Literature search

83 open access papers mention osa-MIR167d
(256 sentences)

Stem-loop

      u  g  c         -              gagugcuuauuaggugaggg 
5' cau ag ag ugaagcugc cagcaugaucugau                    c
   ||| || || ||||||||| ||||||||||||||                    a
3' gug uc uc acuuugacg gucguacuagacua                    g
      u  g  u         u              gaaacaaaaccgucaguuaa 

Deep sequencing

87000 reads, 5.86e+04 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context

• Coordinates (MSU7): Chr7: 4166295-4166404 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001109

Mature sequence osa-miR167d-5p

• Accession: MIMAT0001039
• Previous IDs: osa-miR167d
• Sequence: 11 - ugaagcugccagcaugaucug - 31
• Deep sequencing: 86991 reads, 2 experiments
• Evidence: by similarity; MI0000209
• Database links:
  • RNAcentral:URS00004B5529_39947

Mature sequence osa-miR167d-3p

• Accession: MIMAT0022872
• Sequence: 81 - gaucaugcugugcaguuucauc - 102
• Deep sequencing: 9 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS00002E3FC8_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).