![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR172c |
||||||
Accession | MI0001141 (change log) | |||||
Description | Oryza sativa miR172c stem-loop | |||||
Gene family | MIPF0000035; MIR172 | |||||
Literature search |
![]()
77 open access papers mention osa-MIR172c | |||||
Stem-loop |
g g gugccgcacggcacacguau
5' cuu uugc ggugcagcgucaucaagauucacgu c
||| |||| ||||||||||||||||||||||||| g
3' gag aacg ccacgucguaguaguucuaagugcg g
a a ugcuacugaugugaacuuuu
|
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This sequence is a predicted paralogue of the previously identified miR172 family [1]. It is predicted to target mRNAs coding for APETALA2-like transcription factors. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence osa-miR172c |
|
Accession | MIMAT0001071 |
Sequence |
81 - ugaaucuugaugaugcugcac - 101 |
Deep sequencing | 5068 reads, 2 experiments |
Evidence | by similarity; MI0000215 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|