Stem-loop sequence osa-MIR172c

Accession

MI0001141 (change log)

Description

Oryza sativa miR172c stem-loop

Gene family

MIPF0000035; MIR172

Literature search

77 open access papers mention osa-MIR172c
(455 sentences)

Stem-loop

      g    g                         gugccgcacggcacacguau 
5' cuu uugc ggugcagcgucaucaagauucacgu                    c
   ||| |||| |||||||||||||||||||||||||                    g
3' gag aacg ccacgucguaguaguucuaagugcg                    g
      a    a                         ugcuacugaugugaacuuuu 

Deep sequencing

5068 reads, 3.4e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR172 family [1]. It is predicted to target mRNAs coding for APETALA2-like transcription factors.

Genome context

• Coordinates (MSU7): Chr7: 13111485-13111595 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR172c

• osa-MIR820b: Chr7: 13120534-13120734 [-]
• osa-MIR172c: Chr7: 13111485-13111595 [-]

Database links

• miRBase Tracker:MI0001141

Mature sequence osa-miR172c

• Accession: MIMAT0001071
• Sequence: 81 - ugaaucuugaugaugcugcac - 101
• Deep sequencing: 5068 reads, 2 experiments
• Evidence: by similarity; MI0000215
• Database links:
  • RNAcentral:URS00000D7075_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).