![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-384 |
|||||
Accession | MI0001146 (change log) | ||||
Symbol | MGI:Mir384 | ||||
Description | Mus musculus miR-384 stem-loop | ||||
Gene family | MIPF0000289; mir-384 | ||||
Literature search |
![]()
15 open access papers mention mmu-mir-384 | ||||
Stem-loop |
u aau a a c c -ug aa 5' guua cagg auugu aacaauu cuagg aaug uau u |||| |||| ||||| ||||||| ||||| |||| ||| g 3' caau gucc uaaca uuguuaa gaucc uuac aug u a --- g c a - uga gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-384-5p |
|
Accession | MIMAT0004745 |
Sequence |
16 - uguaaacaauuccuaggcaaugu - 38 |
Deep sequencing | 6285 reads, 33 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-384-3p |
|
Accession | MIMAT0001076 |
Previous IDs | mmu-miR-384 |
Sequence |
57 - auuccuagaaauuguucacaau - 78 |
Deep sequencing | 9044 reads, 30 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|