Stem-loop sequence mmu-mir-384

Accession

MI0001146 (change log)

Symbol

MGI:Mir384

Description

Mus musculus miR-384 stem-loop

Gene family

MIPF0000289; mir-384

Literature search

15 open access papers mention mmu-mir-384
(153 sentences)

Stem-loop

   u    aau    a     a       c     c    -ug   aa 
5'  guua   cagg auugu aacaauu cuagg aaug   uau  u
    ||||   |||| ||||| ||||||| ||||| ||||   |||  g
3'  caau   gucc uaaca uuguuaa gaucc uuac   aug  u
   a    ---    g     c       a     -    uga   gu 

Deep sequencing

15338 reads, 65.8 reads per million, 38 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 105344282-105344369 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mirn384
• MGI:Mir384
• RNAcentral:URS0000655E35_10090
• miRBase Tracker:MI0001146

Mature sequence mmu-miR-384-5p

• Accession: MIMAT0004745
• Sequence: 16 - uguaaacaauuccuaggcaaugu - 38
• Deep sequencing: 6285 reads, 33 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS0000221857_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-384-5p
  • miRDB:mmu-miR-384-5p
  • microrna.org:mmu-miR-384-5p

Mature sequence mmu-miR-384-3p

• Accession: MIMAT0001076
• Previous IDs: mmu-miR-384
• Sequence: 57 - auuccuagaaauuguucacaau - 78
• Deep sequencing: 9044 reads, 30 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS0000440C00_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-384-3p
  • miRDB:mmu-miR-384-3p
  • microrna.org:mmu-miR-384-3p

References

1. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).