![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-196b |
|||||
Accession | MI0001151 (change log) | ||||
Symbol | MGI:Mir196b | ||||
Description | Mus musculus miR-196b stem-loop | ||||
Gene family | MIPF0000031; mir-196 | ||||
Literature search |
![]()
50 open access papers mention mmu-mir-196b | ||||
Stem-loop |
- uc uu u c ucca 5' aacugg ggugau agguagu uc uguuguuggga c |||||| |||||| ||||||| || ||||||||||| 3' uugacu ucauua uccguca ag acgacagcucu c g -- cu c c cuuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. Landgraf et al. confirm expression of miR-196b in mouse by cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-196b-5p |
|
Accession | MIMAT0001081 |
Previous IDs | mmu-miR-196b |
Sequence |
16 - uagguaguuuccuguuguuggg - 37 |
Deep sequencing | 601292 reads, 90 experiments |
Evidence | experimental; cloned [2], Illumina [3,5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-196b-3p |
|
Accession | MIMAT0017170 |
Previous IDs | mmu-miR-196b* |
Sequence |
51 - ucgacagcacgacacugccuuc - 72 |
Deep sequencing | 2234 reads, 40 experiments |
Evidence | experimental; 454 [4], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15105502
"MicroRNA-directed cleavage of HOXB8 mRNA"
Science. 304:594-596(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|