Stem-loop sequence mmu-mir-196b

Accession

MI0001151 (change log)

Symbol

MGI:Mir196b

Description

Mus musculus miR-196b stem-loop

Gene family

MIPF0000031; mir-196

Literature search

50 open access papers mention mmu-mir-196b
(241 sentences)

Stem-loop

   -      uc      uu       u  c           ucca 
5'  aacugg  ggugau  agguagu uc uguuguuggga    c
    ||||||  ||||||  ||||||| || |||||||||||     
3'  uugacu  ucauua  uccguca ag acgacagcucu    c
   g      --      cu       c  c           cuuu 

Deep sequencing

603526 reads, 2.14e+03 reads per million, 90 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. Landgraf et al. confirm expression of miR-196b in mouse by cloning [2].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr6: 52230081-52230165 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000065045 ; Hoxa9-004; intron 1

  OTTMUST00000065044 ; Hoxa9-003; exon 1

  OTTMUST00000096394 ; Hoxa9-005; exon 1

  ENSMUST00000154641 ; Hoxa9-004; intron 1

  ENSMUST00000156540 ; Hoxa9-003; exon 1

  ENSMUST00000174115 ; Hoxa9-005; exon 1

  ENSMUST00000070779 ; 9930038K12Rik-201; exon 2

Database links

• EntrezGene:Mirn196b
• MGI:Mir196b
• RNAcentral:URS000075AEB7_10090
• miRBase Tracker:MI0001151

Mature sequence mmu-miR-196b-5p

• Accession: MIMAT0001081
• Previous IDs: mmu-miR-196b
• Sequence: 16 - uagguaguuuccuguuguuggg - 37
• Deep sequencing: 601292 reads, 90 experiments
• Evidence: experimental; cloned [2], Illumina [3,5]
• Database links:
  • RNAcentral:URS0000611746_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-196b-5p
  • miRDB:mmu-miR-196b-5p
  • microrna.org:mmu-miR-196b-5p

Mature sequence mmu-miR-196b-3p

• Accession: MIMAT0017170
• Previous IDs: mmu-miR-196b*
• Sequence: 51 - ucgacagcacgacacugccuuc - 72
• Deep sequencing: 2234 reads, 40 experiments
• Evidence: experimental; 454 [4], Illumina [5]
• Database links:
  • RNAcentral:URS000052E1A6_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-196b-3p
  • miRDB:mmu-miR-196b-3p

References

1. PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).