Stem-loop mmu-mir-376b

Accession

MI0001162

Symbol

MGI: Mir376b

Description

Mus musculus mmu-mir-376b precursor miRNA mir-368

Gene
family

RF04291; mir-368

Literature search

23 open access papers mention mmu-mir-376b
(47 sentences)

Sequence

42584 reads, 809 reads per million, 75 experiments

ugguauuuaaaagGUGGAUAUUCCUUCUAUGGUUAcgugcuuccuggauaAUCAUAGAGGAACAUCCACUUuuucaguauca
(((((((.(((((((((((.(((((.((((((((((..........).)))))))))))))).))))))))))).)))))))

Structure

       u           A     U         - gugc 
ugguauu aaaagGUGGAU UUCCU CUAUGGUUA c    u
||||||| ||||||||||| ||||| ||||||||| |     
acuauga uuuUUCACCUA AAGGA GAUACUAau g    u
       c           C     -         a gucc 

Annotation confidence High

Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature miR-376b products have been shown to be modified by A to I edits [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chr12: 109723458-109723539 [+]

Clustered miRNAs

16 other miRNAs are < 10 kb from mmu-mir-376b

Mature mmu-miR-376b-5p

• Accession: MIMAT0003388
• Description: Mus musculus mmu-miR-376b-5p mature miRNA
• Sequence: 14 - GUGGAUAUUCCUUCUAUGGUUA - 35
• Evidence: experimental ; cloned [2,4], Illumina [5-6]

Mature mmu-miR-376b-3p

• Accession: MIMAT0001092
• Description: Mus musculus mmu-miR-376b-3p mature miRNA
• Sequence: 51 - AUCAUAGAGGAACAUCCACUU - 71
• Evidence: experimental ; Northern [1], PCR [1], cloned [2,4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


6. PubMed ID: 17322061
   Redirection of silencing targets by adenosine-to-inosine editing of miRNAs
   "Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K"
   "Science (2007) 315:1137-1140