![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-376b |
||||||||||||||||||||||||||||||||||||
Accession | MI0001162 (change log) | |||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir376b | |||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-376b stem-loop | |||||||||||||||||||||||||||||||||||
Gene family | MIPF0000091; mir-368 | |||||||||||||||||||||||||||||||||||
Literature search |
![]()
23 open access papers mention mmu-mir-376b | |||||||||||||||||||||||||||||||||||
Stem-loop |
u u a u cgug u 5' gguauu aaaagguggau uuccu cuaugguua cu c |||||| ||||||||||| ||||| ||||||||| || 3' cuauga uuuuucaccua aagga gauacuaau gg c a c c - ---a u |
|||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||
Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature miR-376b products have been shown to be modified by A to I edits [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-376b-5p |
|
Accession | MIMAT0003388 |
Previous IDs | mmu-miR-376b* |
Sequence |
14 - guggauauuccuucuaugguua - 35 |
Deep sequencing | 23052 reads, 65 experiments |
Evidence | experimental; cloned [2,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-376b-3p |
|
Accession | MIMAT0001092 |
Previous IDs | mmu-miR-376b |
Sequence |
51 - aucauagaggaacauccacuu - 71 |
Deep sequencing | 37083 reads, 78 experiments |
Evidence | experimental; Northern [1], PCR [1], cloned [2,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17322061
"Redirection of silencing targets by adenosine-to-inosine editing of miRNAs"
Science. 315:1137-1140(2007).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|