![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-411 |
||||||||||||||||||||||||||||||||||
Accession | MI0001163 (change log) | |||||||||||||||||||||||||||||||||
Symbol | MGI:Mir411 | |||||||||||||||||||||||||||||||||
Description | Mus musculus miR-411 stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000126; mir-379 | |||||||||||||||||||||||||||||||||
Literature search |
![]()
22 open access papers mention mmu-mir-411 | |||||||||||||||||||||||||||||||||
Stem-loop |
u ug a a a a a - uuu 5' gguacu gag g uagu gaccgu u gcguacg c a |||||| ||| | |||| |||||| | ||||||| | u 3' cuauga cuc c auca cuggca a uguaugc g c a -- c a c c a a ugu |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||
Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the mature sequence from the 3' arm of this hairpin [1]. Landgraf et al. later showed that the 5' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-411-5p |
|
Accession | MIMAT0004747 |
Previous IDs | mmu-miR-411 |
Sequence |
16 - uaguagaccguauagcguacg - 36 |
Deep sequencing | 972367 reads, 98 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-411-3p |
|
Accession | MIMAT0001093 |
Previous IDs | mmu-miR-411;mmu-miR-411* |
Sequence |
51 - uauguaacacgguccacuaacc - 72 |
Deep sequencing | 82836 reads, 79 experiments |
Evidence | experimental; PCR [1], cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|