Stem-loop sequence mmu-mir-411

AccessionMI0001163 (change log)
Symbol MGI:Mir411
DescriptionMus musculus miR-411 stem-loop
Gene family MIPF0000126; mir-379
Literature search

22 open access papers mention mmu-mir-411
(69 sentences)

Stem-loop 
   u      ug   a a    a      a a       - uuu 
5'  gguacu  gag g uagu gaccgu u gcguacg c   a
    ||||||  ||| | |||| |||||| | ||||||| |   u
3'  cuauga  cuc c auca cuggca a uguaugc g   c
   a      --   c a    c      c a       a ugu
Get sequence
Deep sequencing
1055206 reads, 2.59e+03 reads per million, 99 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the mature sequence from the 3' arm of this hairpin [1]. Landgraf et al. later showed that the 5' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109710175-109710256 [+]
sense
ENSMUST00000083543 ; Mir411-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-411
mmu-mir-379chr12: 109709060-109709125 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
Database links

Mature sequence mmu-miR-411-5p

Accession MIMAT0004747
Previous IDsmmu-miR-411
Sequence

16 -  

uaguagaccguauagcguacg

 - 36

Get sequence
Deep sequencing972367 reads, 98 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-411-3p

Accession MIMAT0001093
Previous IDsmmu-miR-411;mmu-miR-411*
Sequence

51 -  

uauguaacacgguccacuaacc

 - 72

Get sequence
Deep sequencing82836 reads, 79 experiments
Evidence experimental; PCR [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).