Stem-loop sequence mmu-mir-412

AccessionMI0001164 (change log)
Symbol MGI:Mir412
DescriptionMus musculus miR-412 stem-loop
Gene family MIPF0000192; mir-412
Literature search

7 open access papers mention mmu-mir-412
(36 sentences)

Stem-loop 
         g g    a    c      c   aa    -    u 
5' ggguau g acgg uggu gaccag ugg  agua auug u
   |||||| | |||| |||| |||||| |||  |||| ||||  
3' cccgug c ugcc auca cugguc acu  ucau uaau u
         g -    g    c      c   --    g    c
Get sequence
Deep sequencing
3806 reads, 9.62 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109743289-109743368 [+]
sense
OTTMUST00000113366 ; Mirg-004; intron 4
OTTMUST00000113367 ; Mirg-001; exon 5
OTTMUST00000113368 ; Mirg-005; intron 5
OTTMUST00000114051 ; Mirg-010; intron 9
OTTMUST00000114052 ; Mirg-009; exon 12
OTTMUST00000114049 ; Mirg-011; exon 14
ENSMUST00000182268 ; Mirg-004; intron 4
ENSMUST00000181543 ; Mirg-001; exon 5
ENSMUST00000183116 ; Mirg-005; intron 5
ENSMUST00000182185 ; Mirg-010; intron 9
ENSMUST00000182499 ; Mirg-009; exon 12
ENSMUST00000183144 ; Mirg-011; exon 14
Clustered miRNAs
< 10kb from mmu-mir-412
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-412-5p

Accession MIMAT0017173
Sequence

15 -  

uggucgaccagcuggaaaguaau

 - 37

Get sequence
Deep sequencing3202 reads, 50 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-412-3p

Accession MIMAT0001094
Previous IDsmmu-miR-412
Sequence

52 -  

uucaccugguccacuagccg

 - 71

Get sequence
Deep sequencing600 reads, 40 experiments
Evidence experimental; PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).