![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-412 |
||||||||||||||||||||||||||||||
Accession | MI0001164 (change log) | |||||||||||||||||||||||||||||
Symbol | MGI:Mir412 | |||||||||||||||||||||||||||||
Description | Mus musculus miR-412 stem-loop | |||||||||||||||||||||||||||||
Gene family | MIPF0000192; mir-412 | |||||||||||||||||||||||||||||
Literature search |
![]()
7 open access papers mention mmu-mir-412 | |||||||||||||||||||||||||||||
Stem-loop |
g g a c c aa - u 5' ggguau g acgg uggu gaccag ugg agua auug u |||||| | |||| |||| |||||| ||| |||| |||| 3' cccgug c ugcc auca cugguc acu ucau uaau u g - g c c -- g c |
|||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||
Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-412-5p |
|
Accession | MIMAT0017173 |
Sequence |
15 - uggucgaccagcuggaaaguaau - 37 |
Deep sequencing | 3202 reads, 50 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-412-3p |
|
Accession | MIMAT0001094 |
Previous IDs | mmu-miR-412 |
Sequence |
52 - uucaccugguccacuagccg - 71 |
Deep sequencing | 600 reads, 40 experiments |
Evidence | experimental; PCR [1], cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|