![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-370 |
||||||||
Accession | MI0001165 (change log) | |||||||
Symbol | MGI:Mir370 | |||||||
Description | Mus musculus miR-370 stem-loop | |||||||
Gene family | MIPF0000167; mir-370 | |||||||
Literature search |
![]()
35 open access papers mention mmu-mir-370 | |||||||
Stem-loop |
g ca gu u u a g 5' agacgga agaccaggu c cuc gcag uac ca c ||||||| ||||||||| | ||| |||| ||| || u 3' ucugucu uuuggucca g ggg cguc gug gu c g ag ug u c a a |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-370-5p |
|
Accession | MIMAT0017174 |
Previous IDs | mmu-miR-370* |
Sequence |
13 - caggucacgucucugcaguu - 32 |
Deep sequencing | 5038 reads, 58 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-370-3p |
|
Accession | MIMAT0001095 |
Previous IDs | mmu-miR-370 |
Sequence |
48 - gccugcugggguggaaccuggu - 69 |
Deep sequencing | 49194 reads, 64 experiments |
Evidence | experimental; PCR [1], cloned [2-3], Illumina [4,6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|