Stem-loop sequence mmu-mir-370

Accession

MI0001165 (change log)

Symbol

MGI:Mir370

Description

Mus musculus miR-370 stem-loop

Gene family

MIPF0000167; mir-370

Literature search

35 open access papers mention mmu-mir-370
(314 sentences)

Stem-loop

          g         ca gu   u    u   a  g 
5' agacgga agaccaggu  c  cuc gcag uac ca c
   ||||||| |||||||||  |  ||| |||| ||| || u
3' ucugucu uuuggucca  g  ggg cguc gug gu c
          g         ag ug   u    c   a  a 

Deep sequencing

54237 reads, 234 reads per million, 70 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr12: 109618258-109618336 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000113329 ; Rian-012; intron 2

  OTTMUST00000113328 ; Rian-010; intron 3

  ENSMUST00000182689 ; Rian-012; intron 2

  ENSMUST00000183215 ; Rian-010; intron 3

Clustered miRNAs

< 10kb from mmu-mir-370

• mmu-mir-341: chr12: 109611500-109611595 [+]
• mmu-mir-1188: chr12: 109611822-109611941 [+]
• mmu-mir-370: chr12: 109618258-109618336 [+]

Database links

• EntrezGene:Mirn370
• MGI:Mir370
• RNAcentral:URS0000662F5D_10090
• miRBase Tracker:MI0001165

Mature sequence mmu-miR-370-5p

• Accession: MIMAT0017174
• Previous IDs: mmu-miR-370*
• Sequence: 13 - caggucacgucucugcaguu - 32
• Deep sequencing: 5038 reads, 58 experiments
• Evidence: experimental; 454 [5], Illumina [6]
• Database links:
  • RNAcentral:URS00001E7E14_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-370-5p
  • miRDB:mmu-miR-370-5p

Mature sequence mmu-miR-370-3p

• Accession: MIMAT0001095
• Previous IDs: mmu-miR-370
• Sequence: 48 - gccugcugggguggaaccuggu - 69
• Deep sequencing: 49194 reads, 64 experiments
• Evidence: experimental; PCR [1], cloned [2-3], Illumina [4,6]
• Database links:
  • RNAcentral:URS00004900F1_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-370-3p
  • miRDB:mmu-miR-370-3p
  • microrna.org:mmu-miR-370-3p

References

1. PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).