miRBase entry: gga-let-7c

Stem-loop gga-let-7c


Accession
MI0001174
Description
Gallus gallus gga-let-7c precursor miRNA
Gene family
MIPF0000002; let-7

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Gga-let-7c is a microRNA (miRNA) that is dominantly expressed in chicken breast muscle libraries [PMC3700833]. It has 26 different isoforms, making it one of the most highly expressed miRNAs [PMC4519947]. Some of the isoforms of gga-let-7c are identical to the reference in miRBase [PMC4519947]. The let-7 family, including gga-let-7c, is abundantly expressed in chicken breast muscle libraries and is among the top 20 most abundant miRNAs [PMC4519947]. In other studies, differentially expressed miRNAs were found in various contexts such as chicken lungs infected with avian influenza virus, A549 cells infected with influenza A virus, mice infected with recombinant influenza A H1N1 virus strains, cynomolgus macaques infected with highly pathogenic H5N1 avian virus, and chicken lung and trachea infected with avian influenza virus [PMC5389138]. In the ovary compared to the testis, gga-let-7a, gga-let-7f and gga-let-7c were down-regulated while gga-miR26a, gga-miR148a and gga-miR451 were up-regulated [PMC3526641].

Literature search
47 open access papers mention gga-let-7c
(330 sentences)

Sequence

1074972 reads, 12632 reads per million, 5 experiments
gcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaaCUGUACAACCUUCUAGCUUUCCuuggagc
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))

Structure
  a      uU   G   U             ua  g ua  c 
gc uccggg  GAG UAG AGGUUGUAUGGUU  ga u  ca  
|| ||||||  ||| ||| |||||||||||||  || |  || c
cg agguuC  UUC AUC UCCAACAUGUCaa  uu a  gu  
  -      CU   G   U             --  g gg  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 99018794-99018877 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from gga-let-7c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gga-let-7c-5p

Accession MIMAT0001104
Description Gallus gallus gga-let-7c-5p mature miRNA
Sequence 11 - UGAGGUAGUAGGUUGUAUGGUU - 32
Evidence experimental
Illumina [2]
Database links
Predicted targets

Mature gga-let-7c-3p

Accession MIMAT0026492
Description Gallus gallus gga-let-7c-3p mature miRNA
Sequence 56 - CUGUACAACCUUCUAGCUUUCC - 77
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 15592404
    Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution
    "International Chicken Genome Sequencing Consortium"
    "Nature (2004) 432:695-716


  2. "McBride D, Carre W, Law A, Clinton M"
    (None) None:

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45