Stem-loop sequence gga-let-7c

AccessionMI0001174 (change log)
DescriptionGallus gallus let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

47 open access papers mention gga-let-7c
(323 sentences)

Stem-loop
     a      uu   g   u             ua  g ua a 
5' gc uccggg  gag uag agguuguaugguu  ga u  c c
   || ||||||  ||| ||| |||||||||||||  || |  | c
3' cg agguuc  uuc auc uccaacaugucaa  uu a  g c
     -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
12419642 reads, 1.48e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 99018794-99018877 [+]
sense
ENSGALT00000028950 ; gga-let-7c-201; exon 1
Clustered miRNAs
< 10kb from gga-let-7c
gga-mir-99achr1: 99018041-99018121 [+]
gga-let-7cchr1: 99018794-99018877 [+]
Database links

Mature sequence gga-let-7c-5p

Accession MIMAT0001104
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Deep sequencing12419310 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-let-7c-3p

Accession MIMAT0026492
Sequence

56 - 

cuguacaaccuucuagcuuucc

 - 77

Get sequence
Deep sequencing293 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).