Stem-loop sequence dps-bantam

AccessionMI0001287 (change log)
DescriptionDrosophila pseudoobscura bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

1 open access papers mention dps-bantam
(2 sentences)

Stem-loop
   au     uac    c          uu      g   -  uu 
5'   uugac   gaaa cgguuuucga  ugguuu acu gu  u
     |||||   |||| ||||||||||  |||||| ||| ||  u
3'   aacug   uuuu gucgaaaguu  acuaga uga ca  u
   --     ---    a          uu      g   a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XR_group8: 4603910-4603990 [-]
intergenic
Database links

Mature sequence dps-bantam

Accession MIMAT0001197
Sequence

52 - 

ugagaucauuuugaaagcugauu

 - 74

Get sequence
Evidence by similarity; MI0000387, MI0000387