Stem-loop sequence dps-let-7

AccessionMI0001288 (change log)
DescriptionDrosophila pseudoobscura let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention dps-let-7
(3 sentences)

Stem-loop
     u      uu   g     g           guacu 
5' uc ggcaaa  gag uagua guuguauagua     u
   || ||||||  ||| ||||| |||||||||||     c
3' ag ucguuu  uuc aucgu uaacauaucau     a
     u      cu   g     g           gcuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 3635655-3635731 [+]
intergenic
Clustered miRNAs
< 10kb from dps-let-7
dps-mir-1004_group3: 3634753-3634852 [+]
dps-let-74_group3: 3635655-3635731 [+]
dps-mir-1254_group3: 3636011-3636120 [+]
Database links

Mature sequence dps-let-7

Accession MIMAT0001198
Sequence

11 - 

ugagguaguagguuguauagu

 - 31

Get sequence
Evidence by similarity; MI0000416, MI0000416