Stem-loop sequence dps-mir-1

AccessionMI0001289 (change log)
DescriptionDrosophila pseudoobscura miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention dps-mir-1
(4 sentences)

Stem-loop
   ---   uuu  --ga            c        a   -  auaa 
5'    gcc   ga    guuccaugcuuc uugcauuc aua gu    c
      |||   ||    |||||||||||| |||||||| ||| ||     
3'    cgg   cu    cgagguaugaag aauguaag uau cg    a
   gaa   --u  aaag            a        g   a  aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 7845323-7845410 [-]
intergenic
Database links

Mature sequence dps-miR-1

Accession MIMAT0001199
Sequence

53 - 

uggaauguaaagaaguauggag

 - 74

Get sequence
Evidence by similarity; MI0000116, MI0000116