Stem-loop sequence dps-mir-2a-1

AccessionMI0001290 (change log)
DescriptionDrosophila pseudoobscura miR-2a-1 stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention dps-mir-2a-1
(8 sentences)

Stem-loop
             -     -         a    auuuug 
5' gcugggcuca caaag ugguuguga augc      c
   |||||||||| ||||| ||||||||| ||||       
3' cggcucgagu guuuc accgacacu uacg      u
             a     g         a    cccguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group5: 1152501-1152574 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2a-1
dps-mir-2b-24_group5: 1152201-1152283 [+]
dps-mir-2a-14_group5: 1152501-1152574 [+]
dps-mir-2a-24_group5: 1153087-1153158 [+]
Database links

Mature sequence dps-miR-2a

Accession MIMAT0001200
Sequence

47 - 

uaucacagccagcuuugaugagc

 - 69

Get sequence
Evidence by similarity; MI0000118, MI0000118