Stem-loop sequence dps-mir-2a-2

AccessionMI0001291 (change log)
DescriptionDrosophila pseudoobscura miR-2a-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention dps-mir-2a-2
(8 sentences)

Stem-loop
       a   c        --             - aua 
5' aucu agc ucaucaag  ugguugugauaug g   c
   |||| ||| ||||||||  ||||||||||||| |    
3' uagg ucg aguaguuu  accgacacuauac c   c
       a   -        cg             g aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group5: 1153087-1153158 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2a-2
dps-mir-2b-24_group5: 1152201-1152283 [+]
dps-mir-2a-14_group5: 1152501-1152574 [+]
dps-mir-2a-24_group5: 1153087-1153158 [+]
Database links

Mature sequence dps-miR-2a

Accession MIMAT0001200
Sequence

44 - 

uaucacagccagcuuugaugagc

 - 66

Get sequence
Evidence by similarity; MI0000118, MI0000118