Stem-loop sequence dps-mir-2b-1

AccessionMI0001292 (change log)
DescriptionDrosophila pseudoobscura miR-2b-1 stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention dps-mir-2b-1
(5 sentences)

Stem-loop
                     -    g    cg  uug  a 
5' cugcgacgcucuuuaaag uggc guga  ug   gu a
   |||||||||||||||||| |||| ||||  ||   ||  
3' ggcguugcgaggaguuuc accg cacu  ac   ua u
                     g    a    au  uua  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 3919049-3919125 [+]
intergenic
Database links

Mature sequence dps-miR-2b

Accession MIMAT0001201
Sequence

48 - 

uaucacagccagcuuugaggagc

 - 70

Get sequence
Evidence by similarity; MI0000120, MI0000120