Stem-loop sequence dps-mir-2b-2

AccessionMI0001293 (change log)
DescriptionDrosophila pseudoobscura miR-2b-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention dps-mir-2b-2
(5 sentences)

Stem-loop
          a          -         a   --uuu  cuu 
5' uuguguc uucuucaaag ugguuguga aug     gc   u
   ||||||| |||||||||| ||||||||| |||     ||    
3' agcacag gaggaguuuc accgacacu uac     cg   u
          c          g         a   uuauc  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group5: 1152201-1152283 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2b-2
dps-mir-2b-24_group5: 1152201-1152283 [+]
dps-mir-2a-14_group5: 1152501-1152574 [+]
dps-mir-2a-24_group5: 1153087-1153158 [+]
Database links

Mature sequence dps-miR-2b

Accession MIMAT0001201
Sequence

54 - 

uaucacagccagcuuugaggagc

 - 76

Get sequence
Evidence by similarity; MI0000120, MI0000120