Stem-loop sequence dps-mir-2c

AccessionMI0001294 (change log)
DescriptionDrosophila pseudoobscura miR-2c stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention dps-mir-2c
(5 sentences)

Stem-loop
   -u   auc    c  u       -      aa      aagaaa     -a   gc 
5'   ggu   cuua uu caguguc aucaaa  uggcug      gauau  uuu  a
     |||   |||| || ||||||| ||||||  ||||||      |||||  |||   
3'   cua   gagu aa guuacgg uaguuu  accgac      cuaug  aag  u
   ag   --c    -  c       g      cg      -----a     cg   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 9824690-9824792 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2c
dps-mir-2c2: 9824690-9824792 [+]
dps-mir-13a2: 9824939-9825012 [+]
dps-mir-13b-12: 9825091-9825159 [+]
Database links

Mature sequence dps-miR-2c

Accession MIMAT0001202
Sequence

64 - 

uaucacagccagcuuugaugggc

 - 86

Get sequence
Evidence by similarity; MI0000431, MI0000431