Stem-loop sequence dps-mir-4

AccessionMI0001296 (change log)
DescriptionDrosophila pseudoobscura miR-4 stem-loop
Gene family MIPF0000305; mir-4
Literature search

1 open access papers mention dps-mir-4
(1 sentences)

Stem-loop
    ug    u gu   uu    c   c   cuuag      u 
5' u  caau a  uuc  uggu guc agc     gugauu c
   |  |||| |  |||  |||| ||| |||     |||||| u
3' g  guug u  aag  acca cag ucg     uacuag c
    gu    c ug   uu    a   a   --aaa      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 12677418-12677498 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-4
dps-mir-3093: 12677889-12677956 [-]
dps-mir-33: 12677755-12677827 [-]
dps-mir-2863: 12677589-12677685 [-]
dps-mir-43: 12677418-12677498 [-]
dps-mir-53: 12677240-12677311 [-]
dps-mir-6-13: 12677098-12677177 [-]
dps-mir-6-23: 12676947-12677029 [-]
dps-mir-6-33: 12676804-12676883 [-]
Database links

Mature sequence dps-miR-4

Accession MIMAT0001204
Sequence

49 - 

auaaagcuagacaaccauuga

 - 69

Get sequence
Evidence by similarity; MI0000122, MI0000122