Stem-loop sequence dps-mir-87

AccessionMI0001319 (change log)
DescriptionDrosophila pseudoobscura miR-87 stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention dps-mir-87
(1 sentences)

Stem-loop
   -------  u     auu        -u  c     g     ------u  -  a 
5'        ca auuuc   cgcgccug  au uugcu aaccg       ag cc u
          || |||||   ||||||||  || ||||| |||||       || || a
3'        gu uaaag   guguggac  ua aacga uuggc       uc gg a
   acgaauu  u     agu        uu  a     g     ccuacuu  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 220121-220218 [+]
intergenic
Database links

Mature sequence dps-miR-87

Accession MIMAT0001225
Sequence

60 - 

uugagcaaaauuucaggugug

 - 80

Get sequence
Evidence by similarity; MI0000382, MI0000382