Stem-loop sequence dps-mir-124

AccessionMI0001323 (change log)
DescriptionDrosophila pseudoobscura miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention dps-mir-124
(1 sentences)

Stem-loop
   -----uc    g  a      ucucc      c      ag    a    uau 
5'        guuu gu cguuuu     ugguau cacugu  gccu uaug   u
          |||| || ||||||     |||||| ||||||  |||| ||||   u
3'        caaa ca gcgaga     accgua guggcg  cgga auac   c
   aucaucu    g  g      -----      a      ca    -    cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 10867628-10867725 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-124
dps-mir-1244_group3: 10867628-10867725 [-]
dps-mir-2874_group3: 10858875-10858954 [-]
Database links

Mature sequence dps-miR-124

Accession MIMAT0001229
Sequence

57 - 

uaaggcacgcggugaaugccaag

 - 79

Get sequence
Evidence by similarity; MI0000373, MI0000373