Stem-loop sequence dps-mir-184

AccessionMI0001326 (change log)
DescriptionDrosophila pseudoobscura miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention dps-mir-184
(1 sentences)

Stem-loop
   ggucgacc    c  u  ua         -     g  -  ccg   gcau 
5'         ggug au cg  cccuuauca uucuc cg cc   ugu    u
           |||| || ||  ||||||||| ||||| || ||   |||     
3'         ccac ua gc  gggaauagu aagag gc gg   aca    a
   cuacucaa    -  u  uc         c     -  a  uca   gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 696716-696815 [+]
intergenic
Database links

Mature sequence dps-miR-184

Accession MIMAT0001232
Sequence

61 - 

uggacggagaacugauaagggc

 - 82

Get sequence
Evidence by similarity; MI0000354, MI0000354