Stem-loop sequence dps-mir-277

AccessionMI0001335 (change log)
DescriptionDrosophila pseudoobscura miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

1 open access papers mention dps-mir-277
(4 sentences)

Stem-loop
   ----   a g       gu  -   gu    -            --  gaaac 
5'     uug a guuuugg  ug cgu  cagg agugcauuugca  cu     a
       ||| | |||||||  || |||  |||| ||||||||||||  ||      
3'     aac u caagacc  ac gca  gucu ucacguaaaugu  ga     u
   uucu   a g       uu  a   ug    a            uc  agucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 5020595-5020694 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-277
dps-mir-3172: 5030001-5030090 [-]
dps-mir-2772: 5020595-5020694 [-]
dps-mir-342: 5019569-5019668 [-]
Database links

Mature sequence dps-miR-277

Accession MIMAT0001241
Sequence

59 - 

uaaaugcacuaucugguacgaca

 - 81

Get sequence
Evidence by similarity; MI0000360, MI0000360