Stem-loop sequence dre-mir-7a-1

AccessionMI0001361
Previous IDsdre-mir-7-1
DescriptionDanio rerio miR-7a-1 stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -------------  u  a     a       u      guuucuu 
5'              ug gg agacu gugauuu guuguu       c
                || || ||||| ||||||| ||||||        
3'              ac cc ucuga cacugaa caacag       u
   ucccgggcgagcg  u  a     -       -      ucuuucg 
Get sequence
Deep sequencing
1158 reads, 123 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
25: 13574416-13574494 [-]
intergenic
Database links

Mature sequence dre-miR-7a

Accession MIMAT0001266
Previous IDsdre-miR-7
Sequence

3 - 

uggaagacuagugauuuuguugu

 - 25

Get sequence
Deep sequencing1544 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).