Stem-loop sequence dre-mir-34a

AccessionMI0001365 (change log)
Previous IDsdre-mir-34a;dre-mir-34
DescriptionDanio rerio miR-34 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cugcu    gu    -  c         -   a          g   gga 
5'      guga  gguu cu uggcagugu cuu gcugguuguu ugu   g
        ||||  |||| || ||||||||| ||| |||||||||| |||   u
3'      cacu  ucaa ga gccgucaua gaa cgacuaacga gca   g
   --uuc    gc    a  c         u   -          a   aga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 22591058-22591155 [+]
sense
OTTDART00000042060 ; si:ch211-28e16.4-001; exon 4
ENSDART00000146709 ; si:ch211-28e16.4-001; exon 4
antisense
OTTDART00000042065 ; si:ch211-28e16.5-001; exon 3
ENSDART00000146966 ; si:ch211-28e16.5-001; exon 3
KZ115683.1: 215231-215328 [+]
sense
OTTDART00000042060 ; si:ch211-28e16.4-001; exon 4
ENSDART00000146709 ; si:ch211-28e16.4-001; exon 4
antisense
OTTDART00000042065 ; si:ch211-28e16.5-001; exon 3
ENSDART00000146966 ; si:ch211-28e16.5-001; exon 3
Database links

Mature sequence dre-miR-34a

Accession MIMAT0001269
Previous IDsdre-miR-34a;dre-miR-34
Sequence

19 - 

uggcagugucuuagcugguugu

 - 40

Get sequence
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).