Stem-loop sequence dre-mir-181b-1

AccessionMI0001366
DescriptionDanio rerio miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cauguacgcaccuucaguucuucaaa       auca          cug    u     ua  cu 
5'                           ggucaua    acauucauug   ucgg ggguu  gu  u
                             |||||||    ||||||||||   |||| |||||  ||   
3'                           ccggugu    uguaaguaac   aguc cucga  ca  g
   --------------------uuagac       -caa          --a    u     --  au 
Get sequence
Deep sequencing
7396 reads, 962 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
2: 45252630-45252738 [-]
intergenic
Database links

Mature sequence dre-miR-181b-5p

Accession MIMAT0001270
Previous IDsdre-miR-181b
Sequence

37 - 

aacauucauugcugucgguggg

 - 58

Get sequence
Deep sequencing5476 reads, 4 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).