Stem-loop sequence dre-mir-182

AccessionMI0001368 (change log)
DescriptionDanio rerio miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
   guau       u -g      uca      ---   g 
5'     uuggcaa g  uagaac   cacugg   uga g
       ||||||| |  ||||||   ||||||   ||| u
3'     aaccguu c  aucuug   guggcc   acu a
   -auc       - ag      ---      uag   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 15075665-15075732 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-182
dre-mir-183chr4: 15074566-15074663 [+]
dre-mir-96chr4: 15074715-15074839 [+]
dre-mir-182chr4: 15075665-15075732 [+]
Database links

Mature sequence dre-miR-182-5p

Accession MIMAT0001271
Previous IDsdre-miR-182
Sequence

4 - 

uuuggcaaugguagaacucaca

 - 25

Get sequence
Evidence experimental; PCR [1], cloned [2]
Database links
Predicted targets

Mature sequence dre-miR-182-3p

Accession MIMAT0001272
Previous IDsdre-miR-182*
Sequence

48 - 

ugguucuagacuugccaacua

 - 68

Get sequence
Evidence experimental; PCR [1]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).