Stem-loop sequence dre-mir-182

AccessionMI0001368
DescriptionDanio rerio miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
   guau       u -g      uca      ---   g 
5'     uuggcaa g  uagaac   cacugg   uga g
       ||||||| |  ||||||   ||||||   ||| u
3'     aaccguu c  aucuug   guggcc   acu a
   -auc       - ag      ---      uag   g 
Get sequence
Deep sequencing
2881 reads, 252 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 14141057-14141124 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-182
dre-mir-1834: 14139958-14140055 [+]
dre-mir-964: 14140107-14140231 [+]
dre-mir-1824: 14141057-14141124 [+]
Database links

Mature sequence dre-miR-182-5p

Accession MIMAT0001271
Previous IDsdre-miR-182
Sequence

4 - 

uuuggcaaugguagaacucaca

 - 25

Get sequence
Deep sequencing2531 reads, 4 experiments
Evidence experimental; PCR [1], cloned [2]

Mature sequence dre-miR-182-3p

Accession MIMAT0001272
Previous IDsdre-miR-182*
Sequence

48 - 

ugguucuagacuugccaacua

 - 68

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; PCR [1]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).