Stem-loop sequence dre-mir-183

AccessionMI0001369
DescriptionDanio rerio miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop
   ---------ga   c        g      --ac     ga        ugaaag 
5'            cuc uguucugu uauggc    uggua  auucacug      c
              ||| |||||||| ||||||    |||||  ||||||||       
3'            gag acgagaca auaccg    accau  uaagugac      a
   gcaccaagaaa   -        a      ggaa     --        uaucac 
Get sequence
Deep sequencing
3711 reads, 571 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 14139958-14140055 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-183
dre-mir-1834: 14139958-14140055 [+]
dre-mir-964: 14140107-14140231 [+]
dre-mir-1824: 14141057-14141124 [+]
Database links

Mature sequence dre-miR-183-5p

Accession MIMAT0001273
Previous IDsdre-miR-183
Sequence

16 - 

uauggcacugguagaauucacug

 - 38

Get sequence
Deep sequencing2854 reads, 4 experiments
Evidence experimental; PCR [1], cloned [2]

Mature sequence dre-miR-183-3p

Accession MIMAT0031921
Sequence

56 - 

ugaauuaccaaagggccauaa

 - 76

Get sequence
Deep sequencing508 reads, 4 experiments
Evidence not experimental

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).