Stem-loop sequence dre-mir-187

AccessionMI0001370 (change log)
Previous IDsdre-mir-187
DescriptionDanio rerio miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   ugaccuguggcu gg   gg                  ----     c  u 
5'             g  cca  ggcugcaacacaggacau    gggag ug c
               |  |||  ||||||||||||||||||    ||||| || u
3'             c  ggu  ccgacguuguguucugug    cccuc ac c
   -----------g aa   ga                  cucg     -  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr19: 34135607-34135695 [+]
antisense
ENSDART00000079070 ; rp9-203; intron 1
Database links

Mature sequence dre-miR-187

Accession MIMAT0001274
Sequence

61 - 

ucgugucuuguguugcagcc

 - 80

Get sequence
Evidence experimental; PCR [1], cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).