Stem-loop sequence dre-mir-192

AccessionMI0001371
DescriptionDanio rerio miR-192 stem-loop
Gene family MIPF0000063; mir-192
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cuaggac       ga  a     -          c    guuug 
5'        acagggu  ug ccuau gaauugacag cagu     c
          |||||||  || ||||| |||||||||| ||||      
3'        ugucccg  ac ggaug cuugacuguc gucg     a
   ------u       uc  c     u          c    accug 
Get sequence
Deep sequencing
1129 reads, 291 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 27698847-27698931 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-192
dre-mir-194a10: 27698667-27698750 [+]
dre-mir-19210: 27698847-27698931 [+]
Database links

Mature sequence dre-miR-192

Accession MIMAT0001275
Sequence

16 - 

augaccuaugaauugacagcc

 - 36

Get sequence
Deep sequencing960 reads, 4 experiments
Evidence experimental; PCR [1], cloned [2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).