Stem-loop sequence dre-mir-199-1

AccessionMI0001373
Previous IDsdre-mir-199a-1
DescriptionDanio rerio miR-199-1 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u  -   u c   auc       u        c   ---    ga 
5'  cc ugc c guc   ccagugu cagacuac ugu   ucag  u
    || ||| | |||   ||||||| |||||||| |||   ||||  c
3'  gg acg g cag   gguuaca gucugaug aca   gguc  a
   -  u   u u   auu       c        -   ugu    au 
Get sequence
Deep sequencing
6133 reads, 3.33e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
20: 14790234-14790320 [+]
antisense
OTTDART00000004875 ; dnm3-001; intron 15
ENSDART00000047039 ; dnm3-201; intron 14
ENSDART00000152641 ; dnm3-001; intron 15
Clustered miRNAs
< 10kb from dre-mir-199-1
dre-mir-199-120: 14790234-14790320 [+]
dre-mir-21420: 14792413-14792512 [+]
Database links

Mature sequence dre-miR-199-5p

Accession MIMAT0001277
Previous IDsdre-miR-199a;dre-miR-199
Sequence

15 - 

cccaguguucagacuaccuguuc

 - 37

Get sequence
Deep sequencing882 reads, 4 experiments
Evidence experimental; cloned [1-2]

Mature sequence dre-miR-199-3p

Accession MIMAT0003155
Previous IDsdre-miR-199*
Sequence

53 - 

uacaguagucugcacauugguu

 - 74

Get sequence
Deep sequencing4620 reads, 4 experiments
Evidence experimental; array [3], in-situ [3]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
3
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).