Stem-loop sequence dre-mir-199-2

AccessionMI0001374 (change log)
Previous IDsdre-mir-199a-2
DescriptionDanio rerio miR-199-2 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   ggaguuuuuguggacgcccgu  c     c       u        c   u    aau 
5'                      cc gccug ccagugu cagacuac ugu cagg   u
                        || ||||| ||||||| |||||||| ||| ||||    
3'                      gg cggau gguuaca gucugaug aca guuu   a
   ---------------------  u     u       c        -   u    gug 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 1376773-1376868 [-]
OTTDART00000039901 ; dnm1a-001; intron 15
ENSDART00000147972 ; dnm1a-001; intron 15
ENSDART00000026535 ; dnm1a-201; intron 15
Database links

Mature sequence dre-miR-199-5p

Accession MIMAT0001277
Previous IDsdre-miR-199a;dre-miR-199

30 - 


 - 52

Get sequence
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence dre-miR-199-3p

Accession MIMAT0003155
Previous IDsdre-miR-199*

68 - 


 - 89

Get sequence
Evidence experimental; array [3], in-situ [3]
Database links


PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).