Stem-loop sequence dre-mir-199-3

AccessionMI0001375
Previous IDsdre-mir-199a-3
DescriptionDanio rerio miR-199-3 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -------cc    --   c     c       u a      c      ucau  u 
5'          uccc  ccu gccug ccagugu c gacuac uguuca    gc g
            ||||  ||| ||||| ||||||| | |||||| ||||||    ||  
3'          aggg  ggg cggau gguuaca g cugaug acaagu    cg c
   cacacacac    uc   u     u       c c      -      ----  a 
Get sequence
Deep sequencing
2513 reads, 1.68e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 48383357-48383454 [-]
sense
OTTDART00000059576 ; si:ch211-286h12.6-001; exon 2
ENSDART00000156709 ; si:ch211-286h12.6-001; exon 2
antisense
OTTDART00000028003 ; dnm2a-002; intron 6
OTTDART00000028002 ; dnm2a-001; intron 14
ENSDART00000131421 ; dnm2a-002; intron 6
ENSDART00000024031 ; dnm2a-001; intron 14
Database links

Mature sequence dre-miR-199-5p

Accession MIMAT0001277
Previous IDsdre-miR-199a;dre-miR-199
Sequence

16 - 

cccaguguucagacuaccuguuc

 - 38

Get sequence
Deep sequencing882 reads, 4 experiments
Evidence experimental; cloned [1-2]

Mature sequence dre-miR-199-3-3p

Accession MIMAT0031922
Sequence

55 - 

acaguaguccgcacauugguu

 - 75

Get sequence
Deep sequencing1816 reads, 4 experiments
Evidence not experimental

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).