Stem-loop sequence dre-mir-203a

AccessionMI0001376
Previous IDsdre-mir-203
DescriptionDanio rerio miR-203a stem-loop
Gene family MIPF0000108; mir-203
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-203. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-203 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, such as translational repression and Argonaute-catalyzed messenger RNA cleavage. miR-203 has been identified as a skin-specific microRNA, and it forms an expression gradient that defines the boundary between proliferative epidermal basal progenitors and terminally differentiating suprabasal cells. It has also been found upregulated in psoriasis and differentially expressed in some types of cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   guguuugggucucuucuggucccu     gc         u    g    a     cua 
5'                         cuggu  agugguucu aaca uuca caguu   u
                           |||||  ||||||||| |||| |||| |||||   c
3'                         gacca  ucaccagga uugu aagu guuaa   u
   ------------------------     gu         u    a    -     aac 
Get sequence
Deep sequencing
109073 reads, 1.52e+04 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
17: 45975669-45975764 [+]
intergenic
Database links

Mature sequence dre-miR-203a-5p

Accession MIMAT0031923
Sequence

32 - 

agugguucuuaacaguucaacagu

 - 55

Get sequence
Deep sequencing112 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-203a-3p

Accession MIMAT0001278
Previous IDsdre-miR-203a
Sequence

70 - 

gugaaauguuuaggaccacuug

 - 91

Get sequence
Deep sequencing88062 reads, 4 experiments
Evidence experimental; cloned [1-2]
Validated targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).