Stem-loop sequence dre-mir-204-1

AccessionMI0001377 (change log)
Previous IDsdre-mir-204
DescriptionDanio rerio miR-204-1 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   ---------------ucauguga   gug        uuu   a    ---a   c 
5'                        ccu   gacuuccc   guc uccu    ugc u
                          |||   ||||||||   ||| ||||    ||| g
3'                        gga   cugaaggg   cgg ggga    aug g
   cgcuuacuacugcggacucgcag   -aa        --u   -    gaua   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 25972068-25972160 [+]
sense
OTTDART00000021500 ; trpm3-001; intron 5
ENSDART00000147188 ; trpm3-001; intron 5
ENSDART00000088033 ; trpm3-201; intron 5
Database links

Mature sequence dre-miR-204-5p

Accession MIMAT0001279
Previous IDsdre-miR-204
Sequence

18 - 

uucccuuugucauccuaugccu

 - 39

Get sequence
Evidence experimental; cloned [1]

Mature sequence dre-miR-204-3p

Accession MIMAT0031924
Sequence

54 - 

ggcugggaagucaaagggacgc

 - 75

Get sequence
Evidence not experimental
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).