Stem-loop sequence dre-mir-205

AccessionMI0001378
Previous IDsdre-mir-205;dre-mir-205-1
DescriptionDanio rerio miR-205 stem-loop
Gene family MIPF0000058; mir-205
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that -- by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2-- Mir-205 is involved in epithelial to mesenchymal transition (EMT) and tumor invasion[citation needed]. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. The cause of miR-200 silencing in naturally-occurring cancer cells, however, remains largely unknown.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aaacua     ca     uc      u    c        --  uag 
5'       cugug  uucua  cuucau ccac ggagucug  ug   u
         |||||  |||||  |||||| |||| ||||||||  ||    
3'       ggcac  aggau  gaagug ggug cuuuagac  ac   u
   -----a     aa     gu      u    a        ua  uug 
Get sequence
Deep sequencing
20776 reads, 2.94e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
23: 33503944-33504032 [+]
intergenic
Database links

Mature sequence dre-miR-205-5p

Accession MIMAT0001280
Previous IDsdre-miR-205
Sequence

19 - 

uccuucauuccaccggagucug

 - 40

Get sequence
Deep sequencing10736 reads, 4 experiments
Evidence experimental; cloned [1-2]

Mature sequence dre-miR-205-3p

Accession MIMAT0031925
Sequence

57 - 

gauuucaguggugugaagugua

 - 78

Get sequence
Deep sequencing7347 reads, 4 experiments
Evidence not experimental

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).