Stem-loop sequence dre-mir-210

AccessionMI0001379
DescriptionDanio rerio miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gca   a    a   acua       u  cgccuau 
5'    ggu agcc cug    acgcaca ug       u
      ||| |||| |||    ||||||| ||        
3'    cca ucgg gac    ugcgugu ac       c
   -ga   a    c   agug       c  cucaccu 
Get sequence
Deep sequencing
3023 reads, 251 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lim et al. cloned this miRNA from D. rerio [1]. The 3' end of the mature sequence was not determined, but was later analysed in a study of many clones in mouse [2]. The most common cloned length is shown here.

Genome context
Coordinates (Zv9) Overlapping transcripts
25: 26371923-26371995 [-]
intergenic
Database links

Mature sequence dre-miR-210-5p

Accession MIMAT0003392
Previous IDsdre-miR-210*
Sequence

8 - 

agccacugacuaacgcacauug

 - 29

Get sequence
Deep sequencing219 reads, 4 experiments
Evidence experimental; cloned [3]

Mature sequence dre-miR-210-3p

Accession MIMAT0001281
Previous IDsdre-miR-210
Sequence

48 - 

cugugcgugugacagcggcuaa

 - 69

Get sequence
Deep sequencing2139 reads, 4 experiments
Evidence experimental; cloned [1,3]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).