Stem-loop sequence dre-mir-181a-1

AccessionMI0001380
Previous IDsdre-mir-213
DescriptionDanio rerio miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   guuu   u   u a   u      cu       a    -gag  a 
5'     gcc cag g aca ucaacg  gucggug guuu    cu a
       ||| ||| | ||| ||||||  ||||||| ||||    ||  
3'     cgg guc c ugu aguugc  cagcuac caaa    gg a
   ----   c   c a   u      --       -    aaaa  u 
Get sequence
Deep sequencing
7278 reads, 1.14e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
22: 24551967-24552050 [-]
intergenic
Database links

Mature sequence dre-miR-181a-5p

Accession MIMAT0001623
Previous IDsdre-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Deep sequencing12317 reads, 4 experiments
Evidence by similarity; MI0001380

Mature sequence dre-miR-181a-3p

Accession MIMAT0001282
Previous IDsdre-miR-213;dre-miR-181a*
Sequence

56 - 

accaucgaccguugauuguacc

 - 77

Get sequence
Deep sequencing846 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).