Stem-loop sequence dre-mir-214

AccessionMI0001381
DescriptionDanio rerio miR-214 stem-loop
Gene family MIPF0000062; mir-214
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-214. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-214 is a vertebrate-specific family of microRNA precursors. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ugacuga a  -  ug               aca            aacuu 
5'        g gc gu  ucugucugccugucu   cuugcugugcag     c
          | || ||  |||||||||||||||   ||||||||||||      
3'        c cg cg  agacagacggacaga   ggacgacauguc     c
   ---uccg c  a  gu               cac            cacgu 
Get sequence
Deep sequencing
2353 reads, 1.42e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
20: 14792413-14792512 [+]
antisense
OTTDART00000004875 ; dnm3-001; intron 15
ENSDART00000047039 ; dnm3-201; intron 14
ENSDART00000152641 ; dnm3-001; intron 15
Clustered miRNAs
< 10kb from dre-mir-214
dre-mir-199-120: 14790234-14790320 [+]
dre-mir-21420: 14792413-14792512 [+]
Database links

Mature sequence dre-miR-214

Accession MIMAT0001283
Sequence

62 - 

acagcaggcacagacaggcag

 - 82

Get sequence
Deep sequencing660 reads, 4 experiments
Evidence experimental; cloned [1-2]
Validated targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).