Stem-loop sequence dre-mir-216a

AccessionMI0001382
Previous IDsdre-mir-216;dre-mir-216a-1
DescriptionDanio rerio miR-216a stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   -    auuuu     u         u   aa       --ua   u 
5'  gcug     uggca aaucucagc ggc  cugugag    gug u
    ||||     ||||| ||||||||| |||  |||||||    |||  
3'  cgac     acugu uuggggucg ucg  gacacuc    uac u
   a    -acac     c         -   cg       uccc   u 
Get sequence
Deep sequencing
77 reads, 8.92 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
22: 31336713-31336801 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-216a
dre-mir-216b22: 31337021-31337097 [-]
dre-mir-216a22: 31336713-31336801 [-]
dre-mir-21722: 31336479-31336576 [-]
Database links

Mature sequence dre-miR-216a

Accession MIMAT0001284
Previous IDsdre-miR-216
Sequence

15 - 

uaaucucagcuggcaacuguga

 - 36

Get sequence
Deep sequencing54 reads, 4 experiments
Evidence experimental; PCR [1], cloned [2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).