Stem-loop sequence dre-mir-221

AccessionMI0001387
DescriptionDanio rerio miR-221 stem-loop
Gene family MIPF0000051; mir-221
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-221_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-221 microRNA (and its paralogue, mir-222) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-221 is an oncogenic microRNA. It targets CD117, which then prevents cell migration and proliferation in endothelial cells. miR-221 is known as an anti angiogenic miRNA. Recent important studies have reported that miR-221 is also involved in induction of angiogenesis. RNA induced Silencing Complex (RISC) proteins SND1 and AEG-1 induces miR-221 expression in Liver cancer. In liver cancer miR-221 induces the tumor angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -------------------   gu     ug   u         auuu     u     
5'                    guc  gaacc  gca acaauguag    cugug ggua 
                      |||  |||||  ||| |||||||||    ||||| ||| c
3'                    cgg  uuugg  cgu uguuacauc    gacau cuau 
   cucgucuuaauaagacgac   ac     gu   c         ----     -     
Get sequence
Deep sequencing
24468 reads, 3.12e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
9: 34892129-34892221 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-221
dre-mir-222a9: 34892661-34892768 [-]
dre-mir-2219: 34892129-34892221 [-]
Database links

Mature sequence dre-miR-221-5p

Accession MIMAT0031926
Sequence

8 - 

accuggcauacaauguagauuucugu

 - 33

Get sequence
Deep sequencing376 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-221-3p

Accession MIMAT0001288
Previous IDsdre-miR-221
Sequence

48 - 

agcuacauugucugcuggguuuc

 - 70

Get sequence
Deep sequencing19908 reads, 4 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).