Stem-loop sequence dre-mir-221

AccessionMI0001387 (change log)
DescriptionDanio rerio miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

10 open access papers mention dre-mir-221
(73 sentences)

Stem-loop
   -------------------   gu     ug   u         auuu     u     
5'                    guc  gaacc  gca acaauguag    cugug ggua 
                      |||  |||||  ||| |||||||||    ||||| ||| c
3'                    cgg  uuugg  cgu uguuacauc    gacau cuau 
   cucgucuuaauaagacgac   ac     gu   c         ----     -     
Get sequence
Deep sequencing
44269 reads, 1.87e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 33920932-33921024 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-221
dre-mir-222achr9: 33921464-33921571 [-]
dre-mir-221chr9: 33920932-33921024 [-]
Database links

Mature sequence dre-miR-221-5p

Accession MIMAT0031926
Sequence

8 - 

accuggcauacaauguagauuucugu

 - 33

Get sequence
Deep sequencing7963 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-221-3p

Accession MIMAT0001288
Previous IDsdre-miR-221
Sequence

48 - 

agcuacauugucugcuggguuuc

 - 70

Get sequence
Deep sequencing36306 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).