Stem-loop sequence dre-mir-222a

AccessionMI0001388
Previous IDsdre-mir-222
DescriptionDanio rerio miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   gccgguggcuu  -uc      u   g   u             -     auc   ugu 
5'            gu   gggugc cau aga gcucaguagucag uguag   cug   c
              ||   |||||| ||| ||| ||||||||||||| |||||   |||   a
3'            cg   uuuacg gua ucu ugggucaucgguc acauc   gac   c
   ----------u  ucu      -   g   c             u     gac   uaa 
Get sequence
Deep sequencing
15948 reads, 2.75e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
9: 34892661-34892768 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-222a
dre-mir-222a9: 34892661-34892768 [-]
dre-mir-2219: 34892129-34892221 [-]
Database links

Mature sequence dre-miR-222a-5p

Accession MIMAT0031927
Sequence

30 - 

ugcucaguagucaguguagaucc

 - 52

Get sequence
Deep sequencing5517 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-222a-3p

Accession MIMAT0001289
Previous IDsdre-miR-222a
Sequence

68 - 

agcuacaucuggcuacugggucuc

 - 91

Get sequence
Deep sequencing8694 reads, 4 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).