Stem-loop sequence dre-mir-223

AccessionMI0001389
Previous IDsdre-mir-223;dre-mir-223-1
DescriptionDanio rerio miR-223 stem-loop
Gene family MIPF0000067; mir-223
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-223. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology MicroRNA-223 (miR-223) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-223 is a hematopoietic specific microRNA with crucial functions in myeloid lineage development. It plays an essential role in promoting granulocytic differentiation while also being associated with the suppression of erythrocytic differentiation. miR-223 is commonly repressed in hepatocellular carcinoma and leukemia. Higher expression levels of miRNA-223 are associated with extranodal marginal-zone lymphoma of mucosa-associated lymphoid tissue of the stomach and recurrent ovarian cancer. In some cancers the microRNA-223 down-regulation is correlated with higher tumor burden, disease aggressiveness, and poor prognostic factors. MicroRNA-223 is also associated with rheumatoid arthritis, sepsis, type 2 diabetes, and hepatic ischemia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cucuccuccugaucuagacu        a a              gugguu       gau 
5'                     cuucucuu g guauuugacagacu      gacacuc   c
                       |||||||| | ||||||||||||||      |||||||   u
3'                     ggagagaa c cauaaacuguuuga      cuguggg   a
   --------------------        c c              ------       gaa 
Get sequence
Deep sequencing
2044 reads, 364 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 24017735-24017833 [-]
intergenic
Database links

Mature sequence dre-miR-223

Accession MIMAT0001290
Sequence

71 - 

ugucaguuugucaaauacccc

 - 91

Get sequence
Deep sequencing1816 reads, 4 experiments
Evidence experimental; PCR [1]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).