Stem-loop sequence cbr-mir-356

AccessionMI0001395 (change log)
DescriptionCaenorhabditis briggsae miR-356 stem-loop
Gene family MIPF0001209; mir-356
Literature search

1 open access papers mention cbr-mir-356
(1 sentences)

Stem-loop
   ----------------------ccucauccaaccaa     a     -aac   -aa      c   u 
5'                                     ugugg ugagc    gcg   caaauc ucu a
                                       ||||| |||||    |||   |||||| |||  
3'                                     acacc acucg    cgc   guuuag aga u
   gagcagaagacuaaggaccguggaagacuuucgguc     -     ccgc   acc      -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at the two terminal positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 12439556-12439667 [-]
intergenic
Database links

Mature sequence cbr-miR-356

Accession MIMAT0001294
Sequence

20 - 

augagcaacgcgaacaaaucc

 - 40

Get sequence
Evidence by similarity; MI0000755

References

1