Stem-loop sequence cbr-mir-358

AccessionMI0001403 (change log)
DescriptionCaenorhabditis briggsae miR-358 stem-loop
Gene family MIPF0000226; mir-358
Stem-loop
   -------a   -  -cauu        u   -     ucc         a  u auaucca 
5'         cuc cc     cggauuga acc cgacu   ggauaccaa ug c       a
           ||| ||     |||||||| ||| |||||   ||||||||| || |        
3'         gag gg     gucuaacu ugg gcuga   ccuaugguu ac g       c
   uguuguga   c  cacau        c   u     -uu         a  u cuuugcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 4 positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrV: 1197871-1197983 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-358
cbr-mir-358chrV: 1197871-1197983 [+]
cbr-mir-357-2chrV: 1198325-1198437 [+]
Database links

Mature sequence cbr-miR-358

Accession MIMAT0001301
Sequence

63 - 

caauugguauccuuagucgugg

 - 84

Get sequence
Evidence by similarity; MI0000757

References

1