Stem-loop sequence cbr-mir-354

AccessionMI0001414 (change log)
DescriptionCaenorhabditis briggsae miR-354 stem-loop
Gene family MIPF0000238; mir-354
Stem-loop
   cc        cuaagugccuu  u     u       -    ucc  -----c   --a   u 
5'   agagccga           gg gcggc acagacg ggua   gg      ucg   ugu c
     ||||||||           || ||||| ||||||| ||||   ||      |||   |||  
3'   uuuugguu           cc cgucg uguuugu ccau   cc      agc   aca a
   --        ---------uu  u     u       u    uuu  uuucuc   gcc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrI: 15400915-15401023 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-354
cbr-mir-354chrI: 15400915-15401023 [-]
cbr-mir-7585chrI: 15397130-15397192 [+]
Database links

Mature sequence cbr-miR-354

Accession MIMAT0001312
Sequence

80 - 

accuuguuuguugcugcuccu

 - 100

Get sequence
Evidence by similarity; MI0000753

References

1