|
miRBase |
|
Stem-loop sequence cbr-mir-41a |
||||||||||||||||||
| Accession | MI0001421 | |||||||||||||||||
| Previous IDs | cbr-mir-41 | |||||||||||||||||
| Description | Caenorhabditis briggsae miR-41 stem-loop | |||||||||||||||||
| Gene family | MIPF0000096; mir-36 | |||||||||||||||||
| Stem-loop |
----- cag aaau ug gua caaca aag
ugaaag guccc gccuugg guuuuucgcc gugaua ucg c
|||||| ||||| ||||||| |||||||||| |||||| |||
auuuuu caggg uggaacc caaaaagugg cacuau agc c
uguuu --a ---c cu -gc ----- aua
|
|||||||||||||||||
| Deep sequencing |
| |||||||||||||||||
| Comments |
This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 3 positions. |
|||||||||||||||||
| Genome context |
|
|||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||
Mature sequence cbr-miR-41a |
|
| Accession | MIMAT0001318 |
| Previous IDs | cbr-miR-41 |
| Sequence |
68 - ucaccgggugaaaaacuccca - 88 |
| Deep sequencing | 29 reads, 1 experiments |
| Evidence | by similarity; MI0000012 |
References |
|
| 1 |
PMID:12672692
"The microRNAs of Caenorhabditis elegans"
Genes Dev. 17:991-1008(2003).
|